Skip to main content

Table 1 Primers used for the analysis of the 9 SMARCB1 coding exons

From: SMARCB1/INI1 germline mutations contribute to 10% of sporadic schwannomatosis

Exon Primer pair
1 5'CCCTCCTGATCCCTCGCAGC/5'CGGGCTACCTCGGAGCCGAT
2 5'CTGCGACCCTTATAATGAGC/5'GCGAGTGGTTTTGAAACAGG
3 5'ACCAGCAGAGTGACCCAGTG/5'AGAGATGCCCTGGCCAGGAA
4 5'GGATCAGGTCCTATACTGAC/5'AACTAAGGCGGAATCAGCAC
5 5'TTGCATACCTAGGGCTCCGG/5'GCCCGACTGCCTTGTACCAT
6 5'TGGTGCAATCTCTTGGCATC/5'TCAGTGCTCCATGATGACAC
7 5'TGGGCTGCAAAAGCTCTAAC/5'CGCTCACACAGAGAAGTCTT
8 5'ATCCACTGGGTGCCAGCAGT/5'TCTGCCTGGAAAGCCAGGTG
9 5'CCCTGTAGAGCCTTGGGAAG/5'GCCTCTGTCCTTGCCAGAAG