Skip to main content

Table 3 Primers for qRT-PCR analysis of integrin α4

From: An immunoassay that distinguishes real neuromyelitis optica signals from a labeling detected in patients receiving natalizumab

Gene Forward primer sequence Reverse primer sequence
α4 INTEG 5′- GGCAAGGAAGTTCCAGGTTACAT -3′ 5′- ATGCTTCCTGTAATCACGTCAGAA -3′
CYCLO 5′- ATGGCAAATGCTGGACCAAA-3′ 5′- CATGTCGTCCCAGTTGGTAACA-3′
β-ACTIN 5′- AGGCCAACCGTGAAAAGATG-3′ 5′- GCCTGGATGGCTACGTACATG-3′
  1. Primers were designed using the Primer Express software (Applied Biosystems).
\