Skip to main content

Table 1 Primers utilized for real-time RT-PCR analysis

From: Microarray analysis identifies a set of CXCR3 and CCR2 ligand chemokines as early IFNβ-responsive genes in peripheral blood lymphocytes in vitro: an implication for IFNβ-related adverse effects in multiple sclerosis

Genes GenBank accession No. Sense primers Antisense primers PCR product (bp)
ISG15
(G1P2)
NM_005101
(M13755)
5'aagcccctgagcaccgtgttcat3' 5'ttgatcctgctcggatgctggtg3' 102
SCYB10
(CXCL10, IP-10)
NM_001565
(X02530)
5'tcgatgcagtgcttccaaggatgg3' 5'ccttcctacaggagtagtagcagc3' 162
SCYA8
(CCL8, MCP2)
NM_005623
(Y10802)
5'tctgtgctgaccccaaggagagat3' 5'taatgtcacactgcacctggggga3' 164
SCYA2
(CCL2, MCP1)
NM_002982
(S71513)
5'ctagctttccccagacaccctgtt3' 5'ccaggggtagaactgtggttcaag3' 197
SCYB2
(CXCL2, GRO2)
NM_002089 5'cccgcatcgcccatggttaagaaa3' 5'tcttctgttcctgtaaggcagggc3' 131
FOS NM_005252 5'gagctggtgcattacagagaggag3' 5'ggacttgagtccacacatggatgc3' 140
RGS14 NM_006480 5'tgacagctacccaacagtccagga3' 5'agggattgggggtgagcttgttga3' 222
G3PDH NM_002046 5'ccatgttcgtcatgggtgtgaacca3' 5'gccagtagaggcagggatgatgttc3' 251
  1. Abbreviations: ISG15, interferon-stimulated gene 15; SCYB10, small inducible cytokine subfamily B, member 10; SCYA8, small inducible cytokine subfamily A, member 8; SCYA2, small inducible cytokine subfamily A, member 2; SCYB2, small inducible cytokine subfamily B, member 2; FOS, cellular oncogene c-fos; RGS14, regulator of G-protein signaling 14; and G3PDH, glyceraldehyde-3-phosphate dehydrogenase