Skip to main content

Table 2 ABCD1 gene primers sequences

From: A novel mutation in the ABCD1 gene of a Moroccan patient with X-linked adrenoleukodystrophy: case report

Exons Forward 5′ to 3′ Reverse 3′ to 5′ Size
1(first part) AGCAACAATCCTTCCAGCCA CACCACGTCCTCCGTCAGA 689
1(second part) CTGCTACCTTCGTCAACAG CCCACACCTTTGGCATCAG 593
2 GTGACTAGAGAGGGAGTGG GGCTTGTCTGAGTGGTAAC 657
3 CATCAGCCTGTGATGTGCTC TGGGCCTCTTGAAGTGACAG 531
4 GTGAAGAAGGCAGCCTTGG CCAGAAGCACATGGAGGTC 509
5 AGACTCCCCAGAATGCAGAG GGCTGAGGCTTGCATATGTG 216
6 CTCTCAAGGCTGGTCAGGAG CTTCACCACTTCCTGGGCCT 312
7 CGATGTGAGCGTGTGGATG GGCACCTGGCACTTTAGAC 372
8 and 9 GGAACTGAGCCAAGACCATT CTGCTGATGACAGCCGCCT 493
10 TGACCCTGTCCCTCTCCTG GCTGCTGTCTCCTTCATGTG 322