Skip to main content

Table 1 Primer sequences used in quantitative real-time PCR

From: Partial loss of VE-cadherin improves long-term outcome and cerebral blood flow after transient brain ischemia in mice

Gene Sense Antisense
Tpp2 CTTCTATCCAAAGGCTCTCAAGG CTCTCCAGGTCTCACCATCATG
VE-cadherin GCAATGGCAGGCCCTAACTTTC CAGCAAACTCTCCTTGGAGCAC
N-cadherin CAGCGCAGTCTTACCGAAGGATG GCTTCTCACAGCATACACCGTGC
occludin GAAAGTCCACCTCCTTACAGACC CATAGCCTCTGTCCCAAGCAAG
claudin-5 CTTCCTGGACCACAACATCGTG CACCGTCGGATCATAGAACTCG
α-catenin GAGCCAGTTTCTCAAGGAGGAG CTGCCATGTCAGCCAGAATCAG
β-catenin GATGTTGACACCTCCCAAGTCC CTCATCTAGCGTCTCAGGGAAC
α-SMA CAGACATCAGGGAGTAATGGTTG GCTCGTTATAGAAAGAGTGGTGC
CD13 GAAGGCCATGTTCAACATCACAC GATTCCAATCTGGACACCATTGG
PDGFR-β CTTTGTGCCAGATCCCACCATG CTGGAGGCTGTAGACGTAGTAAG