Skip to main content

Table 1 Sequences of primers (5′ → 3′) used to construct plasmids encoding various human GFAP alleles

From: Aggregation-prone GFAP mutation in Alexander disease validated using a zebrafish model

Allele Sequences
WT Forward: TAGTAGGATCCATGGAGAGGAGACGCATCAC
Reverse: TAGTCGATATCATCATCACATCCTTGTGCTCCTGCTTG
p.Arg79Cys Forward: GAGATGATGGAGCTCAATGACtGCTTTGCCAGCTACATCGAG
Reverse: CTCGATGTAGCTGGCAAAGCaGTCATTGAGCTCCATCATCTC
p.Arg79His Forward: GAGATGATGGAGCTCAATGACCaCTTTGCCAGCTACATCGAG
Reverse: CTCGATGTAGCTGGCAAAGtGGTCATTGAGCTCCATCATCTC
p.Asp128Asn Forward: GAGAGCTGCGGCTGCGGCTCaATCAACTCACCGCCAACAG
Reverse: CTGTTGGCGGTGAGTTGATtGAGCCGCAGCCGCAGCTCTC
p.Asp157Asn Forward: GCAGAAGCTCCAGaATGAAACCAACCTG
Reverse: CAGGTTGGTTTCATtCTGGAGCTTCTGC
p.Arg239Cys Forward: CAGCCCTGAAAGAGATCtGCACGCAGTATGAGGCAATG
Reverse: CATTGCCTCATACTGCGTGCaGATCTCTTTCAGGGCTG
p.Arg239His Forward: CAGCCCTGAAAGAGATCCaCACGCAGTATGAGGCAATG
Reverse: CATTGCCTCATACTGCGTGtGGATCTCTTTCAGGGCTG
  1. Lower case indicates mutated nucleotides
\