Skip to main content

Table 1 Characteristics of primers used for examining the genes

From: The role of Bordetella pertussis in the development of multiple sclerosis

Primers Sequences (5′ → 3′) Target Size (bp) Tm (°C)
F1-BP TCCGAACCGGATTTGAGAAA IS481 60 78.5
R1-BP CCGGGCTCCTTGAGTGAA    
F1-BpP ATGCTGGATCGCAAGTTGATG IS1001 81 85.8
R2-BpP TGGGTCTTCGGGCCATT    
F1-16S-TQM CGTGTCGTGAGATGTTGGGTTA 16S rDNA 60 78.5
R1-16S-TQM GACGTCATCCCCACCTTCCT