Skip to main content

Advertisement

Table 1 Loci of selected DRD and GRIN2B SNPs and the corresponding primer pairs used for high resolution melt analysis

From: DRD and GRIN2B polymorphisms and their association with the development of impulse control behaviour among Malaysian Parkinson’s disease patients

SNP Chromosome Location Allele changes Amino acid changes Forward primer (5′➔3′) Reverse primer (5′➔3′) Amplicon size (bp)
DRD1 rs4532 chr 5 (q35.2) 19681423 C > T Nil GAACAGAGAAGTCCCTCTCCAC CTGGAAATCTGACTGACCCCTA 147
DRD1 rs4867798 chr 5 (q35.2) 19679572 T > C Nil GGGCTCTTCTTAAGTTGGCTTT GGACACAGATAAATGCAAGGTG 189
DRD1 rs265981 chr 5 (q35.2) 174870940 T > C Nil GCTCTCTCCCAAGGAAGCTC GTGCGTTTGGGGAAAGGATC 141
DRD2/ANKK1 rs1800497 chr 11 (q23.2) 16833244 C > T Glu > Lys CTCTAGGAAGGACATGATGCCC GCAACACAGCCATCCTCAAAG 128
DRD2 rs104894220 chr 11 (q23.2) 16850073 G > A Val > Ile CATGCCCATGCTGTACAATACG GTACCTGCGTTATTGAGTCCGA 126
DRD2 rs144999500 chr 11 (q23.2) 16845792 G > A Pro > Leu GAGCATCTGAGTGGCTTTCTTCTC GAGAAGAATGGGCATGCCAAAG 150
DRD3 rs3732783 chr 3 (q13.31) 20385935 T > C Ala > Ala AGTAGGAGAGGGCATAGTAGGC CTGGGCTATGGCATCTCTGAG 116
DRD3 rs6280 chr 3 (q13.31) 20385961 C > T Gly > Ser AGTAGGAGAGGGCATAGTAGGC CTGGGCTATGGCATCTCTGAG 116
DRD4 rs1800443 chr 11 (p15.5) 579830 T > G Val > Gly TACTGTGCGGCCTCAACGAC GGGTAGGAAGAAGGAGCACAC 104
DRD5 rs144132215 chr 4 (p16.1) 966018 G > T Gly > Trp GTCCATCCTCATCTCCTTCATTCC CTGGAGTCACAGTTCTCTGCAT 159
GRIN2B rs7301328 chr 12 (p13.1) 6778901 G > C Pro > Pro CTCCCTGCAGCCCCTTTTTA CGCCCAGATCCTCGATTTCA 109