Skip to main content
Download PDF

Absence of lenadogene nolparvovec DNA in a brain tumor biopsy from a patient in the REVERSE clinical study, a case report

BMC Neurology volume 22, Article number: 257 (2022) Cite this article

Abstract

Background

Leber Hereditary Optic Neuropathy (LHON) is a rare, maternally-inherited mitochondrial disease that primarily affects retinal ganglion cells (RGCs) and their axons in the optic nerve, leading to irreversible, bilateral severe vision loss. Lenadogene nolparvovec gene therapy was developed as a treatment for patients with vision loss from LHON caused by the most prevalent m.11778G > A mitochondrial DNA point mutation in the MT-ND4 gene. Lenadogene nolparvovec is a replication-defective recombinant adeno-associated virus vector 2 serotype 2 (AAV2/2), encoding the human wild-type MT-ND4 protein. Lenadogene nolparvovec was administered by intravitreal injection (IVT) in LHON patients harboring the m.11778G > A ND4 mutation in a clinical development program including one phase 1/2 study (REVEAL), three phase 3 pivotal studies (REVERSE, RESCUE, REFLECT), and one long-term follow-up study (RESTORE, the follow-up of REVERSE and RESCUE patients).

Case presentation

A 67-year-old woman with MT-ND4 LHON, included in the REVERSE clinical study, received a unilateral IVT of lenadogene nolparvovec in the right eye and a sham injection in the left eye in May 2016, 11.4 months and 8.8 months after vision loss in her right and left eyes, respectively. The patient had a normal brain magnetic resonance imaging with contrast at the time of diagnosis of LHON. Two years after treatment administration, BCVA had improved in both eyes. The product was well tolerated with mild and resolutive anterior chamber inflammation in the treated eye. In May 2019, the patient was diagnosed with a right temporal lobe glioblastoma, IDH-wildtype, World Health Organization grade 4, based on histological analysis of a tumor excision. The brain tumor was assessed for the presence of vector DNA by using a sensitive validated qPCR assay targeting the ND4 sequence of the vector.

Conclusion

ND4 DNA was not detected (below 15.625 copies/μg of genomic DNA) in DNA extracted from the brain tumor, while a housekeeping gene DNA was detected at high levels. Taken together, this data shows the absence of detection of lenadogene nolparvovec in a brain tumor (glioblastoma) of a treated patient in the REVERSE clinical trial 3 years after gene therapy administration, supporting the long-term favorable safety of lenadogene nolparvovec.

Peer Review reports

Background

Leber Hereditary Optic Neuropathy (LHON) is a rare, maternally-inherited mitochondrial disease that primarily affects retinal ganglion cells (RGCs) and their axons in the optic nerve, leading to irreversible, bilateral, and often sequential severe vision loss [1]. The m.11778G > A point mutation in the mitochondrial DNA (mtDNA) MT-ND4 gene is the most prevalent variant causing the disease and is associated with a poor visual prognosis [2, 3].

Lenadogene nolparvovec gene therapy was developed as a treatment for LHON patients affected by the m.11778G > A MT-ND4 mtDNA mutation. The MT-ND4 gene is normally encoded by the mitochondrial genome and expressed and translated by the intramitochondrial machinery.

Lenadogene nolparvovec is a recombinant replication-defective single-stranded deoxyribonucleic acid (DNA) adeno-associated viral vector 2 serotype 2 (AAV2/2). It contains a codon-optimized complementary DNA (cDNA) that encodes the human wild-type mitochondrial ND4 protein under the control of a cytomegalovirus immediate early promoter in an intron-containing expression cassette (beta globin intron, HBB2) flanked by the viral inverted terminal repeats from the vector. The construct includes the cis-acting elements of human cytochrome c oxidase 10 (COX10) mitochondrial ribonucleic acid (mtRNA), thus ensuring efficient delivery of the corresponding hybrid mRNA to the mitochondrial surface where translation of the human ND4 protein occurs coupled with mitochondrial translocation [4, 5].

Hence, lenadogene nolparvovec promotes allotopic expression of the wild type MT-ND4 gene in the RGC nucleus, leading to mRNA cytoplasmic translation of the MT-ND4 subunit, which is ultimately imported within mitochondria to assemble into Complex I, thereby rescuing respiratory chain function, as shown in cell and animal models [4, 6,7,8,9,10].

Lenadogene nolparvovec has been administered in m.11778G > A ND4 LHON patients by intravitreal injection (IVT) in a clinical development program including one phase 1/2 study (REVEAL) [11] and three phase 3 pivotal studies (REVERSE, RESCUE, REFLECT) [12, 13]. In total, 189 MT-ND4 patients were treated with a single unilateral or bilateral IVT of lenadogene nolparvovec with no concerning safety issues other than usually mild intraocular inflammation controlled with topical corticosteroids in most cases. Here, we report on the safety of lenadogene nolparvovec based on the analysis of an excised specimen of brain tumor from a LHON patient carrying the m.11778G > A mutation, who had been monitored for 3 years after unilateral injection with lenadogene nolparvovec in the REVERSE study.

Case presentation

Objective of the analysis of the tumor excision

The aim of the study was to assess lenadogene nolparvovec safety, by evaluating the possible presence of lenadogene nolparvovec viral genomes in a tumor excision and if found, to confirm the absence of integration of lenadogene nolparvovec DNA into tumor cells. Informed consent was given by the patient for use of the data related to the excision for scientific research.

Patient history

A 67-year-old woman with MT-ND4 LHON, included in the REVERSE clinical study, received a unilateral IVT of lenadogene nolparvovec in the right eye and a sham injection in the left eye in May 2016, 11.4 months and 8.8 months after vision loss in her right and left eyes, respectively. The patient had a normal brain magnetic resonance imaging with contrast at the time of diagnosis of LHON. Before injection, the patient’s best-corrected visual acuity (BCVA) was off-chart, assessed as “counting fingers” in both eyes. 2 years after treatment administration, BCVA had improved in both eyes, with a BCVA of 20/160 and 20/400 for the lenadogene nolparvovec- and sham-treated eyes, respectively. The improvement from nadir was - 1.3 LogMAR for the treated eye, and - 0.9 LogMAR for the sham eye. The product was well tolerated with mild and resolutive anterior chamber inflammation in the treated eye. After completing the two-year REVERSE study, the patient enrolled in the long-term RESTORE study for further follow-up. In May 2019, 3 years after unilateral treatment administration, the patient was diagnosed with a right temporal lobe glioblastoma, IDH-wildtype, World Health Organization grade 4, based on histological analysis of a tumor excision which showed a high-grade infiltrating astrocytoma with necrosis and microvascular proliferation. The brain tumor was assessed and considered to be unrelated to the study drug or the study procedure.

Samples and sample processing

The tumor excision was performed on the patient and the tissue was then fixed for 22 hours in 10% neutral buffered formalin, paraffin embedded and stored at room temperature until dispatched to Charles River Laboratories (Evreux, France) for analysis and quantitation of any lenadogene nolparvovec DNA present in the sample. Three tumor excision blocks were analyzed.

DNA was extracted from each tumor excision block in triplicate (3 × 10 μm slices) using the QIAamp® DNA FFPE Tissue Kit (Qiagen, UK) and then pooled to obtain 3 pooled samples. After extraction, DNA concentration and purity (OD ratios) were determined by UV spectrophotometry using a Nanodrop 8000 instrument (Thermo Fischer Scientific, UK). DNA concentration was determined using a Qubit Flex Fluorometer (Thermo Fischer Scientific, UK) and DNA distribution was checked by micro capillary electrophoresis using the Agilent DNA 1000 kit (Agilent, USA).

Feasibility of DNA extraction from formalin-fixed paraffin-embedded excision blocks

To confirm that DNA of adequate quality could be extracted from formalin-fixed paraffin-embedded (FFPE) samples, DNA was extracted from 5 cynomolgus monkey brain samples (i.e. including brain cortex or pons/cerebellar) embedded in paraffin under similar conditions as the patient’s tumor excision samples. All 5 monkey samples had DNA concentrations (cynomolgus monkey ACTB gene) between 44.65 and 235.5 ng/μL. The PCR (polymerase chain reaction) assay for the amplification of the housekeeping gene produced Ct (threshold cycle) values between 25.92 and 29.93, showing that the DNA was of adequate quality for PCR amplification.

DNA was extracted from a positive control sample (i.e. rat liver) to monitor the DNA extraction process. DNA was successfully extracted from the positive control showing that no issues occurred during the extraction process.

DNA was then extracted from the patient tumor excision. Following extraction, triplicate samples were pooled and DNA concentration was measured. Homo sapiens actin beta (ACTB) was used as the housekeeping gene to demonstrate that the quality of DNA extracted from FFPE blocks was adequate for PCR amplification.

qPCR analysis

The detection of lenadogene nolparvovec DNA was evaluated by qPCR (quantitative polymerase chain reaction) using primers specific for the human ND4 sequence. Specificity of the assay and matrix effects were checked using DNA extracted from human blood samples taken from six individuals and spiked with pAAV2/2-ND4. Viral genomes were analyzed using a validated qPCR assay targeting the ND4 transcript region. The following assay validation parameters were determined: dynamic range, detection limit, quantification limits, within-run and between-run precision and accuracy, dilution integrity, matrix effect, selectivity and specificity in human genomic DNA. The DNA extraction recovery yield from human blood after spiking with known amounts of lenadogene nolparvovec was determined and the stability of lenadogene nolparvovec DNA in these samples after storage at − 20 °C was evaluated. Table 1 shows the qPCR assay validation parameters.

Table 1 qPCR assay validation parameters
Full size table

In parallel, a DNA quality control was performed by assessing gene levels of a housekeeping gene, human actin beta (ACTB; Hs03023880_g1, Thermofisher), to check that the quality of the extracted DNA was adequate for PCR amplification and to ensure that any negative results for the ND4 sequence were true negatives. PCR was performed on 96-well plates, using a specific set of primers and probe:

  • forward primer: ND4-F 5′- TCCTGAAGCTGGGTGGTTATG − 3′,

  • reverse primer: ND4-R 5′- GGCTCTTGAGGTCAGTCTGCC − 3′,

  • internal Taqman® probe: ND4b1_MGB.P FAM 5′- CATGGCTTACCCTTTC -3′ MGB.

All samples were spiked with 2.5 × 103 copies of exogenous DNA (Drosophila melanogaster Antp gene), and then assayed by qPCR. The recovery percentage of the measured Antp copy number had to be lower than 50% of the nominal value to consider the PCR as inhibited [14].

Feasibility of DNA extraction from formalin-fixed paraffin-embedded excision blocks

All pooled samples had DNA concentrations between 31.00 and 69.60 ng/μL. Therefore, the impact of any potential contamination was considered to be negligible as none of the samples had PCR inhibition.

Test compound detection by qPCR analysis

Lenadogene nolparvovec was not detected [below the limit of detection (BLD)] in any samples using the ND4 qPCR assay. No PCR inhibition was detected in any sample. All sentinel controls had BLD values, showing that no cross-contamination between samples occurred during the extraction or qPCR procedures.

Discussion

This analysis showed that a sufficient quantity of DNA was extracted from tumor excision blocks embedded in paraffin originating from an MT-ND4 LHON patient. DNA from a housekeeping gene was amplified successfully by PCR from tumor slides, indicating that the DNA quality was adequate for PCR amplification. Lenadogene nolparvovec DNA was not detected in glioblastoma tumor samples from the patient 3 years post-administration of lenadogene nolparvovec, and no PCR inhibition was detected. These results, along with the data accumulated in the five clinical trials conducted with lenadogene nolparvovec to date, demonstrate the long-term safety of lenadogene nolparvovec gene therapy as regards the potential for causing tumoral transformation.

Data from a study in cynomolgus monkeys have shown that lenadogene nolparvovec DNA penetrates the central nervous system (CNS) visual pathways (optic chiasm, optic tract and contralateral optic nerve) following intravitreal administration [12, 14]. As lenadogene nolparvovec is a non-integrating, replication defective vector, vector DNA detected in CNS structures originates from episomal vector DNA and thus, when the passage of vector DNA into the brain occurs, it does not result in vector integration into the genome where further interaction with oncogenes might occur. With regards to immune reactions to the capsid, there have been no reports of long-term expression of intact rAAV particles in the CNS following intraocular administration of rAAV-based gene therapy; only long-term expression of rAAV-delivered transgenes has been reported. The available evidence indicates that intravitreal injection is more likely to distribute rAAV vectors to the CNS than subretinal injection [15, 16]. Following IVT of rAAV2/2 in dogs, rAAV sequences were detected along the visual pathways: optic nerve, optic chiasm, optic tract, lateral geniculate nucleus, colliculus, optical radiation and visual cortex [15]. These data suggest that IVT can lead to anterograde vector genome distribution along the axons of the ganglion cells to the brain. However, so far, there have been no reports of CNS toxicity in preclinical or clinical studies using intravitreal delivery of rAAV vectors, even after long periods of viral vector expression. Indeed, the duration of AAV-delivered transgene expression following just a single dose is essentially permanent in nondividing cells. AAV-delivered transgenes are expressed for more than 6 months in the mouse brain [17] and can persist in other tissues for at least 6 years in primates [18] and at least 8 years in dogs [19, 20]. Importantly, a gene therapy trial has shown that the therapeutic effects of AAV-delivered transgenes can persist for at least 10 years in the human brain [21], and post-mortem analyses in human brain 10 and 8 years post rAAV2 administration directly into the brain (at doses of 1.8 × 1011 vg and 2.4 × 1012 vg, respectively) have demonstrated a lack of CNS toxicity despite long term expression of AAV genome [22].

These data agree with other results accumulated in several intraocular gene therapy programs currently in progress. For example, the University of Miami and the National Eye Institute in the US are developing an rAAV2/ND4 therapy for the treatment of LHON (ScAAV2-P1ND4v2). The 3-year interim results from 14 patients who received a low dose of 1.18 × 109 vg and a medium dose of 5.81 × 109 vg reported that there were no CNS concerns [23]. Similarly, the Huazhong University of Science and Technology in Wuhan, China, has also developed an rAAV2/ND4 vector for IVT in LHON patients with the LHON m11778G > A mitochondrial DNA mutation. After 7 years of follow-up, no adverse events were reported among the 8 of 9 treated patients who completed the 75- to- 90-month follow-up visits. There were no systemic, CNS-related or ocular adverse events over this long term-follow-up period [24, 25].

The outcome of AAV-mediated retinal gene therapy greatly varies among the reported experimental, pre-clinical and clinical studies. While some demonstrate stable transgene expression for up to 6 years and no vector-related relevant immunological adverse events, others observe the induction of innate and adaptive immune responses and/or ocular inflammation that can be paralleled by a loss of transgene expression [26]. However, CNS toxicity has thus far never been reported.

AAV vectors exhibit an improved safety profile compared to other viral vectors because of their low integration frequency, low immunogenicity and the non-pathogenicity of their parental form. Accordingly, a number of rAAV vectors are being developed as delivery cargos for accessing the CNS [27, 28].

In the present investigation, no lenadogene nolparvovec DNA was detected in CNS tumor samples from a patient who developed a glioblastoma tumor 3 years after intravitreal administration of lenadogene nolparvovec in one eye. Although this does not demonstrate an absence of vector distribution to the CNS, it is supportive of the long-term safety of lenadogene nolparvovec. These results are consistent with the previously reported favorable safety profile of lenadogene nolparvovec and the absence of CNS adverse reactions [11,12,13].

Conclusion

In total, 189 MT-ND4 patients were treated with a single unilateral or bilateral IVT of lenadogene nolparvovec with no safety issues or concerns in five clinical studies [11,12,13]. Here, we report the absence of lenadogene nolparvovec in human brain tumor excision tissue obtained 3 years after unilateral intravitreal treatment administration, when using a qPCR assay detection method specific for the human ND4 gene. Thus, this study indicates that the tumor occurrence was unrelated to lenadogene nolparvovec. These results confirm the favorable safety profile of lenadogene nolparvovec gene therapy in MT-ND4 LHON treated patients [11,12,13].

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Abbreviations

LHON:

Leber Hereditary Optic Neuropathy

RGC:

Retinal ganglion cells

mRNA:

Messenger ribonucleic acid

mtDNA:

Mitochondrial deoxyribonucleic acid

mtRNA:

Mitochondrial ribonucleic acid

AAV2/2:

Adeno-associated virus vector 2 serotype 2

IVT:

Intravitreal injection

DNA:

Deoxyribonucleic acid

cDNA:

Codon-optimized complementary DNA

BCVA:

Best-corrected visual acuity

PCR:

Polymerase chain reaction

Ct:

Threshold cycle

qPCR:

Quantitative polymerase chain reaction

CNS:

Central nervous system

rAAV:

Recombinant adeno-associated virus

References

  1. Carelli V, Carbonelli M, de Coo IF, Kawasaki A, Klopstock T, Lagrèze WA, et al. International consensus statement on the clinical and therapeutic Management of Leber Hereditary Optic Neuropathy. J Neuroophthalmol. 2017;37(4):371–81. https://doi.org/10.1097/WNO.0000000000000570.

    Article  PubMed  Google Scholar 

  2. Newman NJ, Carelli V, Taiel M, Yu-Wai-Man P. Visual outcomes in Leber hereditary optic neuropathy patients with the m.11778G.A (MTND4) mitochondrial DNA mutation. J Neuroophthalmol. 2020. https://doi.org/10.1097/WNO.0000000000001045.

  3. Yu-Wai-Man P, Newman NJ, Carelli V, La Morgia C, Biousse V, Bandello FM, et al. Taiel M and Sahel J-A, for the LHON REALITY study group. Natural history of patients with Leber hereditary optic neuropathy—results from the REALITY study. Eye (Lond). 2021. https://doi.org/10.1038/s41433-021-01535-9.

  4. Bonnet C, AugustinS ES, Bénit P, Bouaita A, Rustin P, Sahel J-A, et al. The optimized allotopic expression of ND1 or ND4 genes restores respiratory chain complex I activity in fibroblasts harboring mutations in these genes. Biochim Biophys Acta. 2008. https://doi.org/10.1016/j.bbamcr.2008.04.018.

  5. Cwerman-Thibault H, Augustin S, Lechauve C, Ayache J, Ellouze S, Sahel J-A, et al. Nuclear expression of mitochondrial ND4 leads to the protein assembling in complex I and prevents optic atrophy and visual loss. Mol Ther Methods Clin Dev. 2015. https://doi.org/10.1038/mtm.2015.3.

  6. Bonnet C, Kaltimbacher V, Ellouze S, Augustin S, Bénit P, Forster V, et al. Allotopic mRNA localization to the mitochondrial surface rescues respiratory chain defects in fibroblasts harboring mitochondrial DNA mutations affecting complex I or v subunits. Rejuvenation Res. 2007. https://doi.org/10.1089/rej.2006.0526.

  7. Gray RE, Law RH, Devenish RJ, Nagley P. Allotopic expression of mitochondrial ATP: synthase genes in nucleus of Saccharomyces cerevisiae. Methods Enzymol. 1996. https://doi.org/10.1016/s0076-6879(96)64035-x.

  8. Guy J, Qi X, Pallott F, Schon EA, Manfredi G, Carelli V, et al. Rescue of a mitochondrial deficiency causing Leber hereditary optic neuropathy. Ann Neurol. 2002. https://doi.org/10.1002/ana.10354.

  9. Koilkonda RD, Chou TH, Porciatti V, Hauswirth WW, Guy J. Induction of rapid and highly efficient expression of the human ND4 complex I subunit in the mouse visual system by self-complementary adeno-associated virus. Arch Ophthalmol. 2010. https://doi.org/10.1001/archophthalmol.2010.135.

  10. Koilkonda R, Yu H, Talla V, Porciatti V, Feuer WJ, Hauswirth WW, et al. LHON gene therapy vector prevents visual loss and optic neuropathy induced by G11778A mutant mitochondrial DNA: biodistribution and toxicology profile. Invest Ophthalmol Vis Sci. 2014. https://doi.org/10.1167/iovs.14-15388.

  11. Vignal-Clermont C, Girmens JF, Audo I, Said SM, Errera MH, Plaine L, et al. Safety of intravitreal gene therapy for treatment of subjects with Leber hereditary optic neuropathy due to mutations in the mitochondrial ND4 gene: the REVEAL study. BioDrugs. 2021. https://doi.org/10.1007/s40259-021-00468-9.

  12. Yu-Wai-Man P, Newman NJ, Carelli V, Moster ML, Biousse V, Sadun AA, et al. Bilateral visual improvement with unilateral gene therapy injection for Leber hereditary optic neuropathy. Sci Transl Med. 2020. https://doi.org/10.1126/scitranslmed.aaz7423.

  13. Newman NJ, Yu-Wai-Man P, Carelli V, Moster ML, Biousse V, Vignal-Clermont C, et al. LHON study group. Efficacy and safety of intravitreal gene therapy for Leber hereditary optic neuropathy treated within 6 months of disease onset. Ophthalmology. 2021. https://doi.org/10.1016/j.ophtha.2020.12.012.

  14. Calkins DJ, Yu-Wai-Man P, Newman NJ, Biousse V, Taiel M, Singh P, et al. Biodistribution of intravitreal enadogene nolparvovec gene therapy in non-human Primates. Mol Ther - Methods Clin Dev. 2021. https://doi.org/10.1016/j.omtm.2021.09.013.

  15. Rizzo S, Belting C, Cinelli L, Allegrini L. Visual field changes following implantation of the Argus II retinal prosthesis. Graefes Arch Clin Exp Ophthalmol. 2015. https://doi.org/10.1007/s00417-014-2822-0.

  16. Seitz IP, Michalakis S, Wilhelm B, Reichel FF, Ochakovski GA, Zrenner E, et al. Superior retinal gene transfer and biodistribution profile of subretinal versus intravitreal delivery of AAV8 in nonhuman Primates. Invest Ophthalmol Vis Sci. 2017. https://doi.org/10.1167/iovs.17-22473.

  17. Klein RL, Muir D, King MA, Peel AL, Zolotukhin S, Möller JC, et al. Long-term actions of vector-derived nerve growth factor or brain-derived neurotrophic factor on choline acetyltransferase and Trk receptor levels in the adult rat basal forebrain. Neuroscience. 1999. https://doi.org/10.1016/s0306-4522(98)00537-5.

  18. Rivera VM, Gao GP, Grant RL, Schnell MA, Zoltick PW, Rozamus LW, et al. Long-term pharmacologically regulated expression of erythropoietin in primates following AAV-mediated gene transfer. Blood. 2005. https://doi.org/10.1182/blood-2004-06-2501.

  19. Niemeyer GP, Herzog RW, Mount J, Arruda VR, Tillson DM, Hathcock J, et al. Long-term correction of inhibitor-prone hemophilia B dogs treated with liver-directed AAV2-mediated factor IX gene therapy. Blood. 2009. https://doi.org/10.1182/blood-2008-10-181479.

  20. Stieger K, Schroeder J, Provost N, Mendes-Madeira A, Belbellaa B, Le Meur G, et al. Detection of intact rAAV particles up to 6 years after successful gene transfer in the retina of dogs and primates. Mol Ther. 2009. https://doi.org/10.1038/mt.2008.283.

  21. Chu Y, Bartus RT, Manfredsson FP, Olanow CW, Kordower JH. Long-term post-mortem studies following neurturin gene therapy in patients with advanced Parkinson's disease. Brain. 2020. https://doi.org/10.1093/brain/awaa020.

  22. Leone P, Shera D, McPhee SW, Francis JS, Kolodny EH, Bilaniuk LT, et al. Long-term follow-up after gene therapy for Canavan disease. Sci Transl Med. 2012. https://doi.org/10.1126/scitranslmed.3003454.

  23. Guy J, Feuer WJ, Davis JL, Porciatti V, Gonzalez PJ, Koilkonda RD, et al. Gene therapy for Leber hereditary optic neuropathy: low- and medium-dose visual results. Ophthalmology. 2017. https://doi.org/10.1016/j.ophtha.2017.05.016.

  24. Yang S, Ma S-Q, Wan X, He H, Pei H, Zhao M-J, et al. Long-term outcomes of gene therapy for the treatment of Leber's hereditary optic neuropathy. EBioMedicine. 2016. https://doi.org/10.1016/j.ebiom.2016.07.002.

  25. Yuan J, Zhang Y, Liu H, Wang D, Du Y, Tian Z, et al. Seven-year follow-up of gene therapy for Leber's hereditary optic neuropathy. Ophthalmology. 2020. https://doi.org/10.1016/j.ophtha.2020.02.023.

  26. Bucher K, Rodríguez-Bocanegra E, Dauletbekov D, Fischer MD. Immune responses to retinal gene therapy using adeno-associated viral vectors - implications for treatment success and safety. Prog Retin Eye Res. 2020. https://doi.org/10.1016/j.preteyeres.2020.100915.

  27. Chiha W, Bartlett CA, Petratos S, Fitzgerald M, Harvey AR. Intravitreal application of AAV-BDNF or mutant AAV-CRMP2 protects retinal ganglion cells and stabilizes axons and myelin after partial optic nerve injury. Exp Neurol. 2020. https://doi.org/10.1016/j.expneurol.2019.113167.

  28. Looser ZJ, Barrett MJP, Hirrlinger J, Weber B, Saab AS. Intravitreal AAV-delivery of genetically encoded sensors enabling simultaneous two-photon imaging and electrophysiology of optic nerve axons. Front Cell Neurosci. 2018. https://doi.org/10.3389/fncel.2018.00377.

Download references

Acknowledgements

We extend our thanks to Joanna Moore, ELS (Charles River Laboratories, Evreux, France) for help in the preparation of this manuscript.

Funding

The Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, Georgia, USA, processed and performed brain tissue/tumor analyses with no funding from the sponsor of the study.

Charles River Laboratories, funded by GenSight Biologics, performed sample analyses.

All authors contributed to interpretation of the data and writing of the manuscript without payment as part of a scientific collaboration.

NJN is supported in part by an ophthalmology department core grant from the NIH/NEI (P30 EY006360). PYWM is supported by a Clinician Scientist Fellowship Award (G1002570) from the Medical Research Council (UK), and receives funding from Fight for Sight (UK), the Isaac Newton Trust (UK), Moorfields Eye Charity, the Addenbrooke’s Charitable Trust, the National Eye Research Centre (UK), the UK National Institute of Health Research (NIHR) as part of the Rare Diseases Translational Research Collaboration, and the NIHR Biomedical Research Centre based at Moorfields Eye Hospital NHS Foundation Trust and UCL Institute of Ophthalmology. The views expressed are those of the author(s) and not necessarily those of the NHS, the NIHR or the Department of Health. VC is supported by grants from the Italian Ministry of Health (RF-2018-12366703), the Italian Ministry of Research (20172T2MHH), and Telethon-Italy (GUP15016). VC is also supported by patients’ organizations MITOCON and IFOND, and patients’ donations. JAS is supported by the Agence Nationale de la Recherche within the Programme Investissements d’Avenir, Institut Hospitalo Universitaire FOReSIGHT [ANR-18-IAHU 0001] and LabEx LIFESENSES (ANR-10-LABX-65).

Author information

Authors and Affiliations

  1. Departments of Ophthalmology, Neurology and Neurological Surgery, Neuro-Ophthalmology Unit, Emory Eye Center, Emory University School of Medicine, 1365-B Clifton Road NE, Atlanta, GA, 30322, USA

    Nancy J. Newman & Valérie Biousse

  2. Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA, USA

    Matthew Schniederjan & Pia R. Mendoza

  3. Department of Ophthalmology and Visual Sciences, Vanderbilt University Medical Center, 1161 21st Avenue South, Nashville, TN, 37232, USA

    David J. Calkins

  4. Cambridge Centre for Brain Repair and MRC Mitochondrial Biology Unit, Department of Clinical Neurosciences, University of Cambridge, Cambridge, UK

    Patrick Yu-Wai-Man

  5. Cambridge Eye Unit, Addenbrooke’s Hospital, Cambridge University Hospitals, Cambridge, UK

    Patrick Yu-Wai-Man

  6. Moorfields Eye Hospital, London, UK

    Patrick Yu-Wai-Man

  7. UCL Institute of Ophthalmology, University College London, London, UK

    Patrick Yu-Wai-Man

  8. IRCCS Istituto delle Scienze Neurologiche di Bologna, UOC Clinica Neurologica, Bologna, Italy

    Valerio Carelli

  9. Unit of Neurology, Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna, Italy

    Valerio Carelli

  10. GenSight Biologics, 74 rue du Faubourg Saint Antoine, 75012, Paris, France

    Magali Taiel

  11. Diamond Pharma Services - ProPharma Group, Harlow, CM20 2FB, UK

    Francois Rugiero

  12. Charles River Laboratories, Evreux, France

    Pramila Singh, Alexandra Rogue & Philippe Ancian

  13. Sorbonne Université, INSERM, CNRS, Institut de la Vision, Paris, France

    José-Alain Sahel

  14. Fondation Ophtalmologique A. de Rothschild, Paris, France

    José-Alain Sahel

  15. Department of Ophthalmology, The University of Pittsburgh School of Medicine, Pittsburgh, PA, USA

    José-Alain Sahel

  16. CHNO des Quinze-Vingts, Institut Hospitalo-Universitaire FOReSIGHT, INSERM-DGOS CIC, Paris, France

    José-Alain Sahel

Authors
  1. Nancy J. Newman
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Matthew Schniederjan
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Pia R. Mendoza
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. David J. Calkins
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Patrick Yu-Wai-Man
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Valérie Biousse
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Valerio Carelli
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Magali Taiel
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Francois Rugiero
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Pramila Singh
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Alexandra Rogue
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. José-Alain Sahel
    View author publications

    You can also search for this author in PubMed Google Scholar

  13. Philippe Ancian
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

All authors have read and approved the manuscript. NJN: Writing and editing of the manuscript acquisition of data, and analysis and interpretation of data. MS: Editing of the manuscript and processing of biopsy sample acquisition of data, and analysis and interpretation of data. PRM: Editing of the manuscript and processing of biopsy sample acquisition of data, and analysis and interpretation of data. DJC: Editing of the manuscript and analysis and interpretation of data. PYWM: Editing of the manuscript and analysis and interpretation of data. VB: Editing of the manuscript acquisition of data, and analysis and interpretation of data. VC: Editing of the manuscript and analysis and interpretation of data. MT: Writing and editing of the manuscript and analysis and interpretation of data. FR: Editing of the manuscript and analysis and interpretation of data. PS: Writing and editing of the manuscript and analysis and interpretation of data. AR: Editing of the manuscript and analysis of the biopsy sample. JAS: Editing of the manuscript and analysis and interpretation of data. PA: Editing of the manuscript, analysis of the biopsy sample and analysis and interpretation of data. The author(s) read and approved the final manuscript.

Corresponding author

Correspondence to Nancy J. Newman.

Ethics declarations

Ethics approval and consent to participate

The study was conducted in compliance with the International Conference on Harmonisation, Good Clinical Practice, and applicable regulatory requirements. The protocol was reviewed by an independent and appropriately constituted institutional review board/independent ethics committee. Informed consent was given by the patient for use of the data related to the excision for scientific research.

Consent for publication

Consent for publication is included in the informed consent form signed by all patients; the patient is now deceased.

Competing interests

Nancy J Newman is a consultant for GenSight Biologics, Santhera Pharmaceuticals and Stealth BioTherapeutics, received research support from GenSight Biologics and Santhera Pharmaceuticals, served on the Data Safety Monitoring Board for Quark NAION study, and is a medical legal consultant. David J Calkins is a consultant for GenSight Biologics and Stuart Therapeutics. Patrick Yu-Wai-Man is a consultant for GenSight Biologics and Stealth BioTherapeutics and has received research support from GenSight Biologics and Santhera Pharmaceuticals. Valerio Carelli is a consultant for GenSight Biologics, Santhera Pharmaceuticals and Stealth BioTherapeutics and has received research support from Santhera Pharmaceuticals and Stealth BioTherapeutics. Magali Taiel is employed by GenSight Biologics, the sponsor of these studies. François Rugiero is an employee of Diamond Pharma Services, which received payment for non-clinical consulting. Pramila Singh, Alexandra Rogue and Philippe Ancian are employees of Charles River Laboratories, Evreux, France, which received payment for the conduct of this research from GenSight Biologics. José A Sahel is a cofounder and shareholder of GenSight Biologics and the patent coauthor on allotopic transport. The other authors have no conflicts of interest to declare that are relevant to the content of this article.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Newman, N.J., Schniederjan, M., Mendoza, P.R. et al. Absence of lenadogene nolparvovec DNA in a brain tumor biopsy from a patient in the REVERSE clinical study, a case report. BMC Neurol 22, 257 (2022). https://doi.org/10.1186/s12883-022-02787-y

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12883-022-02787-y

Keywords

BMC Neurology

ISSN: 1471-2377

Contact us